Crispr guide design

Skill rbr7/MedClawMini/skills/crispr-guide-design

Guide foundryFrom its SKILL.md

Install

npx -y skills add rbr7/MedClawMini --skill crispr-guide-design

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

One thing to look at

0 stars0 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.

What its file declares

Copied from the file, not written here

The file declares its own license as MIT. That is the author’s claim about this one file, and it is not the same thing as the license GitHub reports for the repository, which is listed with the other numbers below.

SKILL.md

2.0 KB, 410 tokens by cl100k_base, as published. Nobody here has run it

CRISPR Design Agent

Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.

When to Use

Designing CRISPR knockout/knock-in experiments that need validated guides.
Locating all PAM-compatible target sites in a gene or locus.
Filtering guides by efficiency/off-target metrics before cloning.

Core Capabilities

Target discovery: Scan sequences for PAM motifs (e.g., NGG).
Efficiency scoring: Evaluate GC content, homopolymers, Doench/DeepCRISPR/CFD scores.
Filtering & ranking: Remove risky guides (SNP overlap, off-target hits) and output the best candidates.

Workflow

Resolve gene symbol + organism to canonical transcript coordinates and target region.
Enumerate PAM-compatible sites; extract spacers for the chosen Cas variant.
Score guides (efficiency + specificity) and compute GC metrics.
Run off-target search (≤3 mismatches) to flag problematic loci.
Filter/rank guides, generate cloning oligos/primers, and emit JSON/CSV outputs with coordinates.

Example Usage

python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
    --sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
    --output guides.json

Guardrails

Always state genome build and Cas variant assumptions.
Avoid guides overlapping common SNPs when avoid_variants is true.
Flag high off-target density near coding regions for manual review.

References

See README.md and prompt.md for detailed schema plus supporting literature.

What ships with it: 4 files

9.5 KB alongside SKILL.md, 1 of them executable