agentsclimarketplace

Mageck analysis

Skill FridrichMethod/awesome-skills/skills/mageck-analysis

Analyzes pooled CRISPR screens with MAGeCK (Li et al 2014), covering count generation (mageck count), the RRA two-condition workflow (mageck test using alpha-RRA over per-sgRNA negative-binomial p-values), the MLE multi-condition workflow (mageck mle with explicit design matrix and beta-score output), normalization choice (median vs total vs control-sgRNA vs spike-in), sgRNA efficiency injection, paired-sample testing, time-course design, drug-screen versus dropout-screen design matrices, MAGeCKFlute and MAGeCK-VISPR downstream visualization, and decision logic for when to use MAGeCK vs JACKS / BAGEL2 / drugZ / Chronos. Use when running a fresh CRISPR screen analysis, picking RRA vs MLE for the experimental design, choosing a normalization method from QC signatures, debugging MLE convergence failure or NaN beta scores, comparing MAGeCK output across tools, or building a batch-aware multi-cell-line / multi-condition MLE design matrix.From its SKILL.md

Install
npx -y skills add FridrichMethod/awesome-skills --skill mageck-analysis

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

2 things to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
  • 13 stars13 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.

SKILL.md

23.3 KB, ~6.0k tokens by cl100k_base, as published. Nobody here has run it

Version Compatibility

Reference examples tested with: MAGeCK 0.5.9+, MAGeCKFlute 2.0+ (R/Bioconductor), MAGeCK-VISPR 0.5.6+, pandas 2.2+, numpy 1.26+, matplotlib 3.8+.

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: mageck --version, mageck count --help, mageck test --help, mageck mle --help
  • R: packageVersion('MAGeCKFlute'), ?FluteRRA, ?FluteMLE

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

MAGeCK CRISPR Screen Analysis

"Run MAGeCK on my pooled CRISPR screen" -> Count sgRNAs from FASTQ, normalize across samples, and rank genes by enrichment or depletion using either the robust rank aggregation (RRA) test for two-condition designs or the maximum-likelihood (MLE) model with explicit design matrix for multi-condition / time-course / drug screens.

  • CLI: mageck count -> mageck test for two-condition RRA
  • CLI: mageck mle for multi-condition / time-course / multi-cell-line MLE
  • R: MAGeCKFlute::FluteRRA() / FluteMLE() for downstream visualization and pathway analysis
  • Python: mageck-vispr for interactive QC + result dashboard

RRA vs MLE Decision Tree

Experimental designRecommendedWhy
Two conditions (e.g. drug vs vehicle, treated vs untreated), single cell line, no covariatesmageck test (RRA)RRA is more robust to outlier sgRNAs; faster; default for most published screens
Time series (Day 0 -> Day 7 -> Day 14 -> Day 21)mageck mleRRA cannot model multiple timepoints jointly; MLE estimates per-condition beta scores
Multi-cell-line panel (e.g. DepMap-style 5-50 lines)mageck mle with cell-line covariate, or ChronosMLE handles >2 conditions; Chronos preferred at DepMap scale
Paired samples (each replicate matched donor/cell prep)mageck mle with paired designRRA does not support pairing
Combinatorial (treatment x cell line x time)mageck mle with full factorial designRRA only handles 1 factor
Drug screen (vehicle vs drug, multiple doses)mageck mle with dose covariate OR drugZ (preferred for chemogenomic)drugZ optimized for chemogenomic; see [[drugz-chemogenomic]]
Essentiality (Day 0 -> endpoint, single condition)mageck test for simple dropout; mageck mle if multi-cell-lineRRA suffices; or BAGEL2 for Bayesian essentiality; see [[bagel-essentiality]]
Multi-batch / multi-screen joint analysismageck mle with batch covariate, JACKS for guide efficacy, or ChronosSee [[batch-correction]]

Fails when:

  • Using RRA for time-series and treating each timepoint as a separate test: false-discovery inflation from un-modeled temporal correlation. Use MLE.
  • Using MLE without explicit design matrix in a screen with severe batch effects: beta scores include batch variance. Add batch covariate.
  • Using MAGeCK for drug screens without vehicle control: comparing drug vs Day 0 conflates drug effect with proliferation. Compare drug vs vehicle, not Day 0. See [[drugz-chemogenomic]].

The RRA Algorithm (under the hood)

Why this matters for postdoc-level use: RRA is not "non-parametric"; it tests whether per-gene sgRNA p-value ranks are more clustered toward the extremes than expected under the uniform null. The chain:

  1. mageck count normalizes raw counts (median by default) and outputs *.count_normalized.txt.
  2. mageck test computes a per-sgRNA p-value under a NB model fitted to per-gene variance (mean-variance trend stabilized via empirical Bayes shrinkage; same family as edgeR/DESeq2 but simpler dispersion estimation).
  3. Per-sgRNA p-values are ranked; ranks are normalized to percentile (rho).
  4. For each gene with k sgRNAs, the alpha-RRA score is the minimum over Pr(beta(i, k-i+1) <= rho_i) for i in 1..k -- the probability of observing the i-th smallest rank in a uniform sample.
  5. Gene-level p-value is computed by permuting sgRNA-to-gene assignment to derive an empirical null over alpha-RRA scores.
  6. Multiple-testing correction is Benjamini-Hochberg.

Critical assumption: RRA assumes most sgRNAs are non-changing (used to estimate the NB dispersion). If >40% of sgRNAs change, median normalization fails and the dispersion estimate is biased. Symptom: every gene appears significant. Fix: use control-sgRNA normalization (--norm-method control) with non-targeting controls as the reference.

The MLE Model (under the hood)

Why this matters: MLE assumes the per-sgRNA log-count is Negative-Binomial with mean determined by a linear combination of condition betas plus an sgRNA-efficiency term (if supplied). The chain:

  1. Define a design matrix where rows are samples and columns are conditions; entries are 1 if the sample belongs to the condition, 0 otherwise. A baseline column (all 1s) is required.
  2. Per-gene, the model is log(count_ij) = baseline_i + sum_c (beta_gc * design_jc) + log(sgrna_efficiency_i) + log(size_factor_j) where i is sgRNA, j is sample, c is condition.
  3. The optimizer finds the per-gene beta_gc maximizing the NB likelihood; per-gene Wald-statistic gives a p-value per condition.
  4. Each beta represents the log-fold-change in that condition relative to baseline, accounting for sgRNA efficiency.

Critical assumption: Beta scores are interpretable only when the design matrix is correctly specified. A common error is omitting batch as a covariate -- the resulting betas absorb batch variance. The fix is to add batch columns; the betas then estimate biology after batch adjustment.

Convergence failure: MLE NaN beta scores indicate optimizer divergence -- usually because a gene has too few sgRNAs with non-zero counts in the relevant conditions. The output includes such genes with NaN; do not interpret them as zero effect.

Count sgRNAs from FASTQ

Goal: Quantify sgRNA representation from raw sequencing data.

Approach: Run mageck count to map FASTQ reads to the sgRNA library reference, producing a normalized count matrix and QC summary. Set --norm-method median (default; robust to outliers) or --norm-method control (when many sgRNAs change).

mageck count \
    --list-seq library.csv \                       # sgRNA library: sgRNA id, sequence, gene (in that order)
    --sample-label Plasmid,Day0,Veh_r1,Veh_r2,Drug_r1,Drug_r2 \
    --fastq Plasmid.fq.gz Day0.fq.gz Veh_r1.fq.gz Veh_r2.fq.gz Drug_r1.fq.gz Drug_r2.fq.gz \
    --norm-method median \                         # see normalization decision below
    --output-prefix screen \
    --trim-5 AUTO                                  # length(s) to trim from 5' end; AUTO detects it (int or comma-list also accepted)

# Outputs:
#   screen.count.txt           raw counts
#   screen.count_normalized.txt normalized counts (median-scaled)
#   screen.countsummary.txt    per-sample QC: Gini, reads, mapping rate, % zero-count
#   screen.log                  per-FASTQ mapping stats

Library file format (tab- or comma-separated; first row is header):

sgRNA,Sequence,Gene
BRCA1_1,ATGGATTTATCTGCTCTTCG,BRCA1
BRCA1_2,CAGCAGATACTTGATGCATC,BRCA1
NTC_0001,GACGCATCGAATCAATAGCC,NonTargeting_0001

Normalization Decision

--norm-methodWhen to useMechanismFails when
median (default)Standard screen, <40% guides changeScale each sample to a common median of all guidesHeavy selection (>40% guides change) inflates median, biasing scaling
totalEqual sequencing depth assumed, no outliersScale to total readsSensitive to PCR jackpots / outlier high-count guides
noneAlready-normalized inputs (DEPRECATED for raw FASTQ counting)Skips scalingAlmost never appropriate; only for already-normalized inputs
controlHeavy selection screens; library has ≥500 NTCsScale each sample so non-targeting controls have constant medianRequires --control-sgrna ntcs.txt listing NTC sgRNAs

Diagnostic: Run with median first. If essentialome PR-AUC against CEGv2 is high and Gini is in range, accept. If PR-AUC <0.5 despite reasonable Gini, retry with control -- this isolates whether median normalization was masking the signal.

MAGeCK Test (RRA for Two-Condition)

Goal: Identify genes significantly enriched or depleted between treatment and control.

Approach: Compute per-sgRNA NB-model p-values, rank, apply alpha-RRA to get per-gene scores, permute for gene-level FDR. Outputs separate columns for positive and negative selection.

mageck test \
    --count-table screen.count.txt \
    --treatment-id Drug_r1,Drug_r2 \
    --control-id Veh_r1,Veh_r2 \
    --norm-method median \
    --output-prefix drug_vs_veh \
    --gene-lfc-method median \                     # alternative: mean (less robust)
    --sort-criteria pos                            # rank for positive selection (choices: neg, pos; default neg)
# Outputs: drug_vs_veh.gene_summary.txt (gene-level), drug_vs_veh.sgrna_summary.txt

Gene-summary columns:

ColumnMeaning
idGene symbol
numNumber of sgRNAs in library for this gene
`negscore, pos
`negp-value, pos
`negfdr, pos
`negrank, pos
`neglfc, pos

Interpretation rule: A gene is a strong essential if neg|fdr < 0.05 AND neg|lfc < -1. A gene is a strong resistance hit if pos|fdr < 0.05 AND pos|lfc > 1. Genes with fdr < 0.05 but |lfc| < 0.5 are statistically significant but biologically weak -- worth flagging for orthogonal validation.

MAGeCK MLE (Multi-Condition)

Goal: Estimate gene effects across complex experimental designs with multiple conditions, time points, batches, or covariates.

Approach: Specify a design matrix mapping samples to conditions, then run mageck mle which fits a NB GLM with sgRNA-efficiency term and outputs per-gene per-condition beta scores.

# Design matrix: design.txt (tab-separated)
# Samples must match sample-label in mageck count output
# baseline column must be present and all 1
cat > design.txt <<EOF
Samples	baseline	day7	day14	day21
Day0	1	0	0	0
Day7_r1	1	1	0	0
Day7_r2	1	1	0	0
Day14_r1	1	0	1	0
Day14_r2	1	0	1	0
Day21_r1	1	0	0	1
Day21_r2	1	0	0	1
EOF

mageck mle \
    --count-table screen.count.txt \
    --design-matrix design.txt \
    --output-prefix timecourse_mle \
    --norm-method median \
    --sgrna-efficiency efficiency.txt \            # OPTIONAL: from JACKS or library design
    --sgrna-eff-name-column 0 \                    # 0-based; 0 is the default
    --sgrna-eff-score-column 1 \                   # 0-based; 1 is the default
    --max-sgrnapergene-permutation 40              # skip genes with more sgRNAs than this (default 40)
# Outputs: timecourse_mle.gene_summary.txt with beta scores per condition + Wald p-values

Gene-summary columns (MLE):

ColumnMeaning
GeneGene symbol
sgRNANumber of sgRNAs
`<condition>beta`
`<condition>z`
`<condition>p-value`
`<condition>fdr`
`<condition>wald-fdr`

Interpretation rule: Beta scores are log2-fold-changes; a beta of -1 in condition day21 means sgRNAs are 2-fold depleted in day-21 relative to baseline. NaN betas indicate convergence failure (typically a gene with too few non-zero counts in that condition); exclude from interpretation.

Sample MAGeCK Test for Drug Screen with sgRNA Efficiency

mageck test \
    --count-table screen.count.txt \
    --treatment-id Drug_r1,Drug_r2,Drug_r3 \
    --control-id Veh_r1,Veh_r2,Veh_r3 \
    --norm-method control \                         # NTCs as normalization reference
    --control-sgrna ntcs.txt \                      # one NTC sgRNA per line
    --gene-lfc-method median \
    --variance-estimation-samples Day0_r1,Day0_r2 \  # estimate variance from these samples
    --output-prefix drug_screen_normalized
# --sgrna-efficiency / --sgrna-eff-name-column / --sgrna-eff-score-column are `mageck mle` options,
# not `mageck test` options; pass them to mle if guide-efficacy weighting is needed.

Reading order: Run mageck count -> screen-qc skill for QC -> mageck test or mageck mle -> MAGeCKFlute for visualization -> downstream pathway analysis.

Time-Course Analysis

Goal: Identify genes with consistent depletion or enrichment across multiple time points.

Approach: Run mageck mle with a design matrix where each timepoint is a separate column, then test for monotonic trends in per-condition beta scores.

import pandas as pd
import numpy as np

def time_course_consistency(mle_results, conditions=['day7', 'day14', 'day21']):
    '''Identify genes with monotonic beta trends across timepoints.
    Returns genes where all betas same sign and trend is monotone.'''
    beta_cols = [f'{c}|beta' for c in conditions]
    fdr_cols = [f'{c}|fdr' for c in conditions]
    df = mle_results[['Gene'] + beta_cols + fdr_cols].copy()
    df['all_negative'] = (df[beta_cols] < 0).all(axis=1)
    df['all_positive'] = (df[beta_cols] > 0).all(axis=1)
    df['monotone'] = df[beta_cols].apply(lambda x: (np.diff(x) <= 0).all() or (np.diff(x) >= 0).all(), axis=1)
    df['any_sig'] = (df[fdr_cols] < 0.05).any(axis=1)
    return df[df['monotone'] & df['any_sig']].sort_values(beta_cols[-1])

Visualizing Results

Goal: Generate publication-grade volcano plot and rank plot of MAGeCK output.

Approach: Load gene_summary.txt, plot -log10(fdr) vs LFC, color by significance, annotate top hits.

import matplotlib.pyplot as plt
import numpy as np

def volcano(gene_summary_path, direction='neg', fdr_threshold=0.05, lfc_threshold=1.0):
    '''direction: "neg" for dropout, "pos" for enrichment.'''
    df = pd.read_csv(gene_summary_path, sep='\t')
    lfc_col = f'{direction}|lfc'
    fdr_col = f'{direction}|fdr'
    fig, ax = plt.subplots(figsize=(9, 7))
    sig = (df[fdr_col] < fdr_threshold) & (np.abs(df[lfc_col]) > lfc_threshold)
    ax.scatter(df.loc[~sig, lfc_col], -np.log10(df.loc[~sig, fdr_col].clip(lower=1e-10)),
                c='lightgray', alpha=0.4, s=10)
    ax.scatter(df.loc[sig, lfc_col], -np.log10(df.loc[sig, fdr_col].clip(lower=1e-10)),
                c='red' if direction == 'neg' else 'blue', alpha=0.7, s=18)
    top = df.loc[sig].nsmallest(15, fdr_col)
    for _, r in top.iterrows():
        ax.annotate(r['id'], (r[lfc_col], -np.log10(max(r[fdr_col], 1e-10))), fontsize=7)
    ax.axhline(-np.log10(fdr_threshold), ls='--', c='black', lw=0.5)
    ax.axvline(0, c='gray', lw=0.5)
    ax.set_xlabel(f'{direction} LFC')
    ax.set_ylabel(f'-log10({direction} FDR)')
    return fig

MAGeCKFlute Integration (R)

Goal: Use the canonical pathway-analysis dashboard for downstream visualization.

Approach: Load MAGeCK output in R, run FluteRRA or FluteMLE, which produces volcano, rank, square-plot, and KEGG/Reactome enrichment.

library(MAGeCKFlute)
# After mageck test
FluteRRA(gene_summary = "drug_vs_veh.gene_summary.txt",
         sgrna_summary = "drug_vs_veh.sgrna_summary.txt",
         organism = "hsa",
         outdir = "flute_output/")

# After mageck mle
FluteMLE(gene_summary = "timecourse_mle.gene_summary.txt",
         treatname = "day21", ctrlname = "baseline",
         organism = "hsa",
         outdir = "flute_mle_output/")

MAGeCK-VISPR Interactive Dashboard

mageck-vispr init my_screen
# Edit config.yaml to point to counts + library
snakemake --cores 8                 # mageck-vispr generates a Snakemake workflow; run it with snakemake
vispr server results/*.vispr.yaml   # serve the interactive dashboard

Failure Modes

NaN beta scores in MLE output

Trigger: A gene has fewer than 2 non-zero-count sgRNAs in the relevant condition. Mechanism: MLE optimizer cannot fit beta when likelihood is flat (insufficient evidence). Symptom: mle.gene_summary.txt shows NaN in specific gene-condition cells. Fix: Filter these genes from downstream interpretation; they are not "zero effect" but undetermined. If many genes show NaN, the screen depth is too low or many guides have failed -- audit with screen-qc.

Every gene appears significant after RRA

Trigger: >40% of sgRNAs change direction (heavy selection screen). Mechanism: Median normalization assumes most guides are non-changing; under heavy selection, median is biased and dispersion estimation breaks. Symptom: Thousands of "hits" at FDR <0.05; volcano plot looks like a U with no separation. Fix: Switch to --norm-method control with non-targeting controls; or use BAGEL2 / Chronos for essentiality analysis (mageck is not designed for screens with high-fraction true essentiality).

MLE beta absorbs batch variance

Trigger: Multi-batch screen run without explicit batch covariate in design matrix. Mechanism: Without a batch column, beta_condition includes both biological signal and batch difference between conditions. Symptom: Beta scores differ between batches for the same biological condition; PCA shows samples cluster by batch not condition. Fix: Add batch covariate columns to design matrix (e.g., one column per batch indicator); the biological betas are then estimated after batch adjustment. See [[batch-correction]].

sgRNA-efficiency injection makes scores worse

Trigger: Supplied JACKS efficiency scores from a different cell line / chemistry than the current screen. Mechanism: sgRNA efficacy is cell-line and modality dependent; HEK293T efficiency is not HCT116 efficiency; Cas9 efficiency is not CRISPRi efficiency. Symptom: Some genes that were hits without efficiency become non-significant with efficiency. Fix: Use efficiency derived from JACKS run on the matching cell line / library / chemistry, or use no efficiency (treat all sgRNAs as equal).

Lack of cell-line covariate in multi-line screen

Trigger: Running mageck mle on multiple cell lines without a cell-line indicator column. Mechanism: Each cell line has different essentiality profile; combining without indicator pools variance and dilutes per-line signal. Symptom: Per-line known essentials don't show up; results look like a meta-analysis without effect sizes. Fix: Add cell-line indicator columns; or move to Chronos which models cell-line and screen-quality jointly (see [[hit-calling]]).

Reconciliation: When MAGeCK Disagrees With Other Tools

PatternLikely causeAction
MAGeCK FDR significant, BAGEL2 Bayes factor notDifferent reference set; BAGEL2 trained on CEGv2/NEGv1Trust BAGEL2 for essentiality calling; MAGeCK for general LFC
MAGeCK significant, JACKS notJACKS down-weighted noisy guides; MAGeCK trusts all 4Inspect per-sgRNA scores; if one sgRNA dominates, JACKS is right
MAGeCK and Chronos agree at top 100; disagree at 100-300Chronos accounts for CN and screen quality; MAGeCK does notTrust Chronos for cancer-line screens; MAGeCK lacks CN correction
MAGeCK significant, drugZ notdrugZ uses bidirectional Z; MAGeCK uses RRAFor chemogenomic, trust drugZ (vehicle-anchored)
RRA and MLE disagree on same dataRRA more robust to outliers; MLE more sensitiveHigher-ranked hits in both = high confidence; only-one-method = orthogonal validate

Quantitative Thresholds

ThresholdValueSource / Rationale
Hit FDR (gene-level)<0.05MAGeCK paper Li 2014; standard
Hit LFC magnitude>1 (2-fold)Biologically interpretable effect size; FDR-only hits at low LFC need validation
Normalization fraction-changing threshold<40% guides change for median normMedian-normalization assumption (most guides unchanged)
sgRNAs needed for reliable MLE≥3 per gene with non-zero counts in each conditionMAGeCK 0.5+ behavior; below this, NaN
Time-course conditions for MLE≥3 (otherwise use test)MLE statistical power
PR-AUC of ranked hits against CEGv2>0.7 for "passing" essentiality screenCommunity convention (CEGv2 from Hart 2017); see [[screen-qc]]
RRA permutation passes per gene100 default; raise via --additional-rra-parameters "--permutation N"Not exposed directly on mageck test; trades runtime

Common Errors

Error / symptomCauseSolution
mageck count outputs mostly zero countsLibrary column order swapped, or wrong --trim-5 lengthLibrary must be sgRNA id, sequence, gene; try --trim-5 AUTO
All genes significantMedian normalization break (heavy selection)--norm-method control
NaN beta in MLEGene with insufficient non-zero countsExclude from interpretation
Two-condition MLE works but ranks differ from RRADifferent test statisticBoth correct; check direction and use the appropriate one
Hits include amplified genesNo CN correctionSee [[copy-number-correction]]
Library not detected in screen.countsummary.txtLibrary file format wrongCheck column order is sgRNA id, sequence, gene (no spaces)

References

  • Li W et al. 2014. Genome Biol 15:554. MAGeCK; original alpha-RRA algorithm.
  • Li W et al. 2015. Genome Biol 16:281. MAGeCK-VISPR; QC + visualization.
  • Wang B et al. 2019. Nat Protoc 14:756. MAGeCKFlute pathway analysis.
  • Joung J et al. 2017. Nat Protoc 12:828. Screen protocol.
  • Hart T et al. 2017. G3 7:2719. CEGv2/NEGv1 reference sets for benchmarking.

Related Skills

  • crispr-screens/screen-qc - Pre-MAGeCK QC; gates whether to use median or control normalization
  • crispr-screens/jacks-analysis - Joint efficacy + essentiality; alternative to MLE
  • crispr-screens/bagel-essentiality - BAGEL2 Bayes-factor calling; alternative for essentiality
  • crispr-screens/drugz-chemogenomic - drugZ for chemogenomic screens; alternative for drug screens
  • crispr-screens/hit-calling - Cross-method decision tree
  • crispr-screens/copy-number-correction - CRISPRcleanR / Chronos for cancer-line CN correction
  • crispr-screens/batch-correction - Multi-batch design-matrix construction
  • pathway-analysis/gsea - Downstream GSEA on ranked hits
  • pathway-analysis/go-enrichment - GO enrichment of hit lists

What ships with it: 2 files

9.4 KB alongside SKILL.md, 1 of them executable

examples/

Keep looking

Skills are one crate of 325,949. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.