agentsclimarketplace
Sign in

Crispr offtarget predictor

Skill FridrichMethod/awesome-skills/skills/crispr-offtarget-predictor

Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.From its SKILL.md

Install
npx -y skills add FridrichMethod/awesome-skills --skill crispr-offtarget-predictor

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

2 things to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
  • 13 stars13 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.

SKILL.md

1.8 KB, 410 tokens by cl100k_base, as published. Nobody here has run it

<!-- # COPYRIGHT NOTICE # This file is part of the "Universal Biomedical Skills" project. # Copyright (c) 2026 MD BABU MIA, PhD <[email protected]> # All Rights Reserved. # # This code is proprietary and confidential. # Unauthorized copying of this file, via any medium is strictly prohibited. # # Provenance: Authenticated by MD BABU MIA -->

CRISPR Off-Target Predictor

This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.

When to Use This Skill

  • Designing new CRISPR experiments.
  • Validating sgRNA specificity before synthesis.
  • Analyzing potential safety risks in gene editing protocols.

Core Capabilities

  1. Mismatch Scoring: Calculates mismatch penalties for potential sites.
  2. PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
  3. Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.

Workflow

  1. Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
  2. Analysis: Scans a reference library (mocked for this version) for similar sequences.
  3. Output: List of potential off-targets with locations and risk scores.

Example Usage

User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."

Agent Action:

python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

What ships with it: 1 file

3.2 KB alongside SKILL.md, 1 of them executable

Keep looking

Skills are one crate of 325,949. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.