agentsclimarketplace
Sign in

Crispr guide design

Skill FridrichMethod/awesome-skills/skills/crispr-guide-design

Guide foundryFrom its SKILL.md

Install
npx -y skills add FridrichMethod/awesome-skills --skill crispr-guide-design

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

2 things to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
  • 13 stars13 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.

What its file declares

Copied from the file, not written here

The file declares its own license as MIT. That is the author’s claim about this one file, and it is not the same thing as the license GitHub reports for the repository, which is listed with the other numbers below.

SKILL.md

2.5 KB, 532 tokens by cl100k_base, as published. Nobody here has run it

<!-- # COPYRIGHT NOTICE # This file is part of the "Universal Biomedical Skills" project. # Copyright (c) 2026 MD BABU MIA, PhD <[email protected]> # All Rights Reserved. # # This code is proprietary and confidential. # Unauthorized copying of this file, via any medium is strictly prohibited. # # Provenance: Authenticated by MD BABU MIA -->

CRISPR Design Agent

Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.

When to Use

  • Designing CRISPR knockout/knock-in experiments that need validated guides.
  • Locating all PAM-compatible target sites in a gene or locus.
  • Filtering guides by efficiency/off-target metrics before cloning.

Core Capabilities

  1. Target discovery: Scan sequences for PAM motifs (e.g., NGG).
  2. Efficiency scoring: Evaluate GC content, homopolymers, Doench/DeepCRISPR/CFD scores.
  3. Filtering & ranking: Remove risky guides (SNP overlap, off-target hits) and output the best candidates.

Workflow

  1. Resolve gene symbol + organism to canonical transcript coordinates and target region.
  2. Enumerate PAM-compatible sites; extract spacers for the chosen Cas variant.
  3. Score guides (efficiency + specificity) and compute GC metrics.
  4. Run off-target search (≤3 mismatches) to flag problematic loci.
  5. Filter/rank guides, generate cloning oligos/primers, and emit JSON/CSV outputs with coordinates.

Example Usage

python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
    --sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
    --output guides.json

Guardrails

  • Always state genome build and Cas variant assumptions.
  • Avoid guides overlapping common SNPs when avoid_variants is true.
  • Flag high off-target density near coding regions for manual review.

References

  • See README.md and prompt.md for detailed schema plus supporting literature.
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

What ships with it: 4 files

11.2 KB alongside SKILL.md, 1 of them executable

Keep looking

Skills are one crate of 326,835. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.