agentsclimarketplace
Sign in

Bio workflows smrna pipeline

Skill FridrichMethod/awesome-skills/skills/bio-workflows-smrna-pipeline

End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.From its SKILL.md

Install
npx -y skills add FridrichMethod/awesome-skills --skill bio-workflows-smrna-pipeline

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

2 things to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
  • 13 stars13 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.

SKILL.md

2.2 KB, 526 tokens by cl100k_base, as published. Nobody here has run it

<!-- # COPYRIGHT NOTICE # This file is part of the "Universal Biomedical Skills" project. # Copyright (c) 2026 MD BABU MIA, PhD <[email protected]> # All Rights Reserved. # # This code is proprietary and confidential. # Unauthorized copying of this file, via any medium is strictly prohibited. # # Provenance: Authenticated by MD BABU MIA -->

Small RNA-seq Pipeline

Pipeline Overview

FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction

Step 1: Preprocessing

# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
    --minimum-length 18 --maximum-length 30 \
    -o trimmed.fastq.gz reads.fastq.gz

Step 2: miRDeep2 Analysis

# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
    -m -p genome_index -s reads_collapsed.fa \
    -t reads_collapsed_vs_genome.arf

# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
    reads_collapsed_vs_genome.arf \
    mature_ref.fa none hairpin_ref.fa

Step 3: Differential Expression

library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)

Step 4: Target Prediction

# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt

QC Checkpoints

  1. After trimming: Size distribution should peak at 21-23nt
  2. After alignment: >70% mapping rate expected
  3. After DE: Check volcano plot and PCA

Related Skills

  • small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
  • small-rna-seq/differential-mirna - DE analysis
  • small-rna-seq/target-prediction - Target analysis
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

What ships with it: 2 files

3.9 KB alongside SKILL.md, 1 of them executable

examples/

Keep looking

Skills are one crate of 325,949. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.