Bio primer design primer validation
Skill FridrichMethod/awesome-skills/skills/bio-primer-design-primer-validation
Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.From its SKILL.md
npx -y skills add FridrichMethod/awesome-skills --skill bio-primer-design-primer-validationAssembled from the repository path, not quoted from the project. Check it against their README if it does not work.
2 things to look at
- no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
- 13 stars13 stars. Stars are a popularity signal and not a quality one, but at this level it is likely that nobody has read this closely except its author, and you would be relying on your own review.
SKILL.md
10.3 KB, ~3.3k tokens by cl100k_base, as published. Nobody here has run it
Primer Validation
Check primers for secondary structures, dimers, and other issues using primer3-py.
Required Imports
import primer3
Check Hairpin Formation
primer = 'ATGCGATCGATCGATCGATC'
hairpin = primer3.calc_hairpin(primer)
print(f'Hairpin Tm: {hairpin.tm:.1f}C')
print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol')
print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol')
print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K')
# Hairpin is problematic if Tm > annealing temp - 10
annealing_temp = 60.0
if hairpin.tm > annealing_temp - 10:
print(f'WARNING: Hairpin Tm too high for annealing at {annealing_temp}C')
Check Self-Dimer (Homodimer)
primer = 'ATGCGATCGATCGATCGATC'
homodimer = primer3.calc_homodimer(primer)
print(f'Homodimer Tm: {homodimer.tm:.1f}C')
print(f'Homodimer dG: {homodimer.dg:.1f} cal/mol')
# Self-dimer is problematic if Tm is close to annealing temp
if homodimer.tm > 40:
print('WARNING: Significant self-dimer potential')
Check Primer-Primer Dimer (Heterodimer)
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'Heterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')
if heterodimer.tm > 40:
print('WARNING: Significant primer dimer potential between forward and reverse')
Complete Primer Validation
def validate_primer(primer_seq, name='Primer', annealing_temp=60.0):
'''Comprehensive primer validation'''
print(f'\n=== Validating {name}: {primer_seq} ===')
# Basic properties
tm = primer3.calc_tm(primer_seq)
gc = (primer_seq.count('G') + primer_seq.count('C')) / len(primer_seq) * 100
print(f'Length: {len(primer_seq)}bp')
print(f'Tm: {tm:.1f}C')
print(f'GC: {gc:.1f}%')
# Hairpin
hairpin = primer3.calc_hairpin(primer_seq)
print(f'Hairpin Tm: {hairpin.tm:.1f}C, dG: {hairpin.dg:.1f}')
if hairpin.tm > annealing_temp - 10:
print(' WARNING: Hairpin may interfere with annealing')
# Homodimer
homodimer = primer3.calc_homodimer(primer_seq)
print(f'Homodimer Tm: {homodimer.tm:.1f}C, dG: {homodimer.dg:.1f}')
if homodimer.tm > 40:
print(' WARNING: Self-dimer potential')
# 3' end stability (last 5 bases)
end_3 = primer_seq[-5:]
end_gc = (end_3.count('G') + end_3.count('C'))
print(f"3' end (last 5bp): {end_3}, {end_gc} G/C bases")
if end_gc > 3:
print(" WARNING: 3' end may be too GC-rich")
if end_gc == 0:
print(" WARNING: 3' end lacks GC clamp")
# Poly-X runs
for base in 'ATGC':
for run_len in range(5, len(primer_seq)):
if base * run_len in primer_seq:
print(f' WARNING: Contains {base}x{run_len} run')
break
return {'tm': tm, 'gc': gc, 'hairpin_tm': hairpin.tm, 'homodimer_tm': homodimer.tm}
validate_primer('ATGCGATCGATCGATCGATC', 'Forward')
Validate Primer Pair
def validate_primer_pair(forward, reverse, annealing_temp=60.0):
'''Validate a primer pair'''
print(f'\n=== Primer Pair Validation ===')
print(f'Forward: {forward}')
print(f'Reverse: {reverse}')
# Individual primer checks
fwd_tm = primer3.calc_tm(forward)
rev_tm = primer3.calc_tm(reverse)
print(f'\nTm Forward: {fwd_tm:.1f}C')
print(f'Tm Reverse: {rev_tm:.1f}C')
print(f'Tm Difference: {abs(fwd_tm - rev_tm):.1f}C')
if abs(fwd_tm - rev_tm) > 2:
print(' WARNING: Tm difference > 2C')
# Heterodimer check
heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'\nHeterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')
if heterodimer.tm > 40:
print(' WARNING: Significant primer dimer potential')
# Check 3' complementarity specifically
end_heterodimer = primer3.calc_heterodimer(forward[-6:], reverse[-6:])
print(f"3' end heterodimer Tm: {end_heterodimer.tm:.1f}C")
if end_heterodimer.tm > 20:
print(" WARNING: 3' ends may form stable dimer")
# Individual hairpins and homodimers
fwd_hairpin = primer3.calc_hairpin(forward)
rev_hairpin = primer3.calc_hairpin(reverse)
fwd_homodimer = primer3.calc_homodimer(forward)
rev_homodimer = primer3.calc_homodimer(reverse)
print(f'\nForward hairpin Tm: {fwd_hairpin.tm:.1f}C')
print(f'Reverse hairpin Tm: {rev_hairpin.tm:.1f}C')
print(f'Forward homodimer Tm: {fwd_homodimer.tm:.1f}C')
print(f'Reverse homodimer Tm: {rev_homodimer.tm:.1f}C')
return {
'fwd_tm': fwd_tm,
'rev_tm': rev_tm,
'heterodimer_tm': heterodimer.tm,
'fwd_hairpin_tm': fwd_hairpin.tm,
'rev_hairpin_tm': rev_hairpin.tm,
}
validate_primer_pair('ATGCGATCGATCGATCGATC', 'GCTAGCTAGCTAGCTAGCTA')
Calculate End Stability (Native Function)
# Use native calc_end_stability for 3' end thermodynamics
primer = 'ATGCGATCGATCGATCGATC'
# Calculate stability of last 5 bases (default)
end_stability = primer3.calc_end_stability(primer)
print(f"3' end stability: dG = {end_stability.dg:.1f} cal/mol")
# More negative dG = more stable 3' end = better extension but higher mispriming risk
if end_stability.dg < -9000:
print(' Note: Very stable 3\' end - good extension but watch for mispriming')
Quick Tm-Only Checks (Lightweight)
# For high-throughput screening, use Tm-only functions (return float, not ThermoResult)
primer = 'ATGCGATCGATCGATCGATC'
# Quick hairpin Tm check
hairpin_tm = primer3.calc_hairpin_tm(primer)
print(f'Hairpin Tm: {hairpin_tm:.1f}C')
# Quick homodimer Tm check
homodimer_tm = primer3.calc_homodimer_tm(primer)
print(f'Homodimer Tm: {homodimer_tm:.1f}C')
# Quick heterodimer Tm check
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer_tm = primer3.calc_heterodimer_tm(forward, reverse)
print(f'Heterodimer Tm: {heterodimer_tm:.1f}C')
Fast Batch Screening with Tm-Only Functions
def quick_screen_primers(primer_list, max_hairpin_tm=45, max_homodimer_tm=45):
'''Fast screening using Tm-only functions'''
passed = []
failed = []
for seq in primer_list:
hairpin_tm = primer3.calc_hairpin_tm(seq)
homodimer_tm = primer3.calc_homodimer_tm(seq)
if hairpin_tm < max_hairpin_tm and homodimer_tm < max_homodimer_tm:
passed.append(seq)
else:
failed.append((seq, hairpin_tm, homodimer_tm))
return passed, failed
primers = ['ATGCGATCGATCGATCGATC', 'GCGCGCGCGCGCGCGCGCGC', 'ATATATATATATATATATAT']
passed, failed = quick_screen_primers(primers)
print(f'Passed: {len(passed)}, Failed: {len(failed)}')
Check Specificity (3' End)
def check_3prime_specificity(primer_seq):
'''Check if 3' end is suitable for specific priming'''
end_5bp = primer_seq[-5:]
end_3bp = primer_seq[-3:]
# Count G/C in last 5 bases
gc_5 = end_5bp.count('G') + end_5bp.count('C')
# Check last base
last_base = primer_seq[-1]
print(f"3' sequence: ...{end_5bp}")
print(f"G/C in last 5bp: {gc_5}")
print(f"Last base: {last_base}")
# Ideal: 1-2 G/C in last 5, ending in G or C
if gc_5 == 0:
print(' Consider: No GC clamp at 3\' end')
elif gc_5 > 3:
print(' Consider: 3\' end may be too stable (mispriming risk)')
if last_base in 'AT':
print(' Consider: Ending in A/T may reduce specificity')
return {'gc_5': gc_5, 'last_base': last_base}
check_3prime_specificity('ATGCGATCGATCGATCGATC')
Batch Validation
import pandas as pd
def batch_validate_primers(primers):
'''Validate multiple primers'''
results = []
for name, seq in primers.items():
tm = primer3.calc_tm(seq)
gc = (seq.count('G') + seq.count('C')) / len(seq) * 100
hairpin = primer3.calc_hairpin(seq)
homodimer = primer3.calc_homodimer(seq)
results.append({
'name': name,
'sequence': seq,
'length': len(seq),
'tm': round(tm, 1),
'gc_pct': round(gc, 1),
'hairpin_tm': round(hairpin.tm, 1),
'homodimer_tm': round(homodimer.tm, 1),
})
return pd.DataFrame(results)
primers = {
'GAPDH_F': 'GTCTCCTCTGACTTCAACAGCG',
'GAPDH_R': 'ACCACCCTGTTGCTGTAGCCAA',
'ACTB_F': 'CATGTACGTTGCTATCCAGGC',
'ACTB_R': 'CTCCTTAATGTCACGCACGAT',
}
df = batch_validate_primers(primers)
print(df.to_string(index=False))
Thermodynamic Parameters Under Different Conditions
primer = 'ATGCGATCGATCGATCGATC'
# Standard conditions
tm_standard = primer3.calc_tm(primer)
hairpin_standard = primer3.calc_hairpin(primer)
# Custom salt conditions
tm_custom = primer3.calc_tm(primer, mv_conc=100.0, dv_conc=2.0, dntp_conc=0.4, dna_conc=200.0)
hairpin_custom = primer3.calc_hairpin(primer, mv_conc=100.0, dv_conc=2.0)
print(f'Standard conditions: Tm={tm_standard:.1f}C, Hairpin Tm={hairpin_standard.tm:.1f}C')
print(f'Custom conditions: Tm={tm_custom:.1f}C, Hairpin Tm={hairpin_custom.tm:.1f}C')
Validation Thresholds
| Property | Acceptable | Optimal |
|---|---|---|
| Length | 18-30 bp | 20-25 bp |
| Tm | 55-65C | 58-62C |
| GC% | 35-65% | 45-55% |
| Hairpin Tm | <45C | <35C |
| Homodimer Tm | <45C | <35C |
| Heterodimer Tm | <45C | <35C |
| 3' GC (last 5bp) | 1-3 | 2 |
Related Skills
- primer-basics - Design new primers with primer3
- qpcr-primers - Design and validate qPCR assays
- database-access/local-blast - BLAST primers against genome for specificity
What ships with it: 2 files
3.8 KB alongside SKILL.md, 1 of them executable
examples/
- validate_primers.pyruns1.9 KB
- usage-guide.md1.9 KB