agentsclimarketplace

Ncbi blast api

Skill brycewang-stanford/Auto-Empirical-Research-Skills/skills/43-wentorai-research-plugins/skills/domains/biomedical/ncbi-blast-api

Run sequence similarity searches via the NCBI BLAST REST APIFrom its SKILL.md

Install
npx -y skills add brycewang-stanford/Auto-Empirical-Research-Skills --skill ncbi-blast-api

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

One thing to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.

SKILL.md

6.4 KB, ~1.7k tokens by cl100k_base, as published. Nobody here has run it

NCBI BLAST REST API

Overview

BLAST (Basic Local Alignment Search Tool) is the most widely used bioinformatics tool, comparing nucleotide or protein sequences against databases to find regions of similarity. The NCBI BLAST REST API enables programmatic submission of searches, status polling, and result retrieval. Free, no authentication required (but rate-limited).

API Workflow

BLAST searches are asynchronous: submit → poll → retrieve.

Step 1: Submit Search

# Nucleotide BLAST (blastn)
curl -X POST "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi" \
  -d "CMD=Put&PROGRAM=blastn&DATABASE=nt&QUERY=ATGCGATCGATCG..."

# Protein BLAST (blastp)
curl -X POST "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi" \
  -d "CMD=Put&PROGRAM=blastp&DATABASE=nr&QUERY=MKTLLLTLVVVTIVCL..."

# BLAST with specific parameters
curl -X POST "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi" \
  -d "CMD=Put&PROGRAM=blastn&DATABASE=nt&QUERY=SEQUENCE&\
EXPECT=0.001&WORD_SIZE=11&HITLIST_SIZE=50"

Step 2: Check Status

# Poll for completion (returns XML with Status field)
curl "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Get&FORMAT_OBJECT=SearchInfo&RID=YOUR_RID"

Step 3: Retrieve Results

# Get results in XML
curl "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Get&FORMAT_TYPE=XML&RID=YOUR_RID"

# Get results in JSON
curl "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Get&FORMAT_TYPE=JSON2_S&RID=YOUR_RID"

# Get results in tabular format
curl "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Get&FORMAT_TYPE=Tabular&RID=YOUR_RID"

BLAST Programs

ProgramQuery → DatabaseUse case
blastnNucleotide → NucleotideDNA/RNA similarity
blastpProtein → ProteinProtein homology
blastxTranslated nuc → ProteinFind protein homologs of DNA
tblastnProtein → Translated nucFind DNA encoding similar protein
tblastxTranslated nuc → Translated nucCompare at protein level

Common Databases

DatabaseContent
ntAll GenBank nucleotide sequences
nrNon-redundant protein sequences
refseq_rnaRefSeq RNA sequences
refseq_proteinRefSeq protein sequences
swissprotUniProtKB/Swiss-Prot (curated)
pdbProtein Data Bank sequences

Key Parameters

ParameterDescriptionDefault
PROGRAMBLAST programRequired
DATABASETarget databaseRequired
QUERYSequence or accessionRequired
EXPECTE-value threshold10
WORD_SIZEWord size11 (blastn), 6 (blastp)
HITLIST_SIZEMax results100
MATRIXScoring matrix (protein)BLOSUM62
FILTERLow complexity filterL
ENTREZ_QUERYRestrict to organismHomo sapiens[ORGN]

Python Usage

import time
import requests
from xml.etree import ElementTree

BLAST_URL = "https://blast.ncbi.nlm.nih.gov/blast/Blast.cgi"


def submit_blast(sequence: str, program: str = "blastn",
                 database: str = "nt",
                 evalue: float = 0.001) -> str:
    """Submit a BLAST search, return Request ID."""
    resp = requests.post(BLAST_URL, data={
        "CMD": "Put",
        "PROGRAM": program,
        "DATABASE": database,
        "QUERY": sequence,
        "EXPECT": evalue,
        "HITLIST_SIZE": 50,
    })
    resp.raise_for_status()

    for line in resp.text.split("\n"):
        if "RID = " in line:
            return line.split("=")[1].strip()
    raise ValueError("No RID in response")


def wait_for_results(rid: str, poll_interval: int = 15,
                     max_wait: int = 300) -> bool:
    """Poll until BLAST search completes."""
    elapsed = 0
    while elapsed < max_wait:
        resp = requests.get(BLAST_URL, params={
            "CMD": "Get",
            "FORMAT_OBJECT": "SearchInfo",
            "RID": rid,
        })
        if "Status=READY" in resp.text:
            return True
        if "Status=FAILED" in resp.text:
            raise RuntimeError("BLAST search failed")
        time.sleep(poll_interval)
        elapsed += poll_interval
    raise TimeoutError(f"BLAST timed out after {max_wait}s")


def get_results(rid: str) -> list:
    """Retrieve BLAST results as parsed hits."""
    resp = requests.get(BLAST_URL, params={
        "CMD": "Get",
        "FORMAT_TYPE": "XML",
        "RID": rid,
    })
    resp.raise_for_status()

    root = ElementTree.fromstring(resp.text)
    ns = ""
    hits = []
    for hit in root.iter(f"{ns}Hit"):
        hsps = hit.find(f"{ns}Hit_hsps")
        hsp = hsps.find(f"{ns}Hsp") if hsps is not None else None
        hits.append({
            "accession": hit.findtext(f"{ns}Hit_accession", ""),
            "description": hit.findtext(f"{ns}Hit_def", ""),
            "length": int(hit.findtext(f"{ns}Hit_len", "0")),
            "evalue": float(hsp.findtext(f"{ns}Hsp_evalue", "999"))
                     if hsp is not None else 999,
            "identity": float(hsp.findtext(f"{ns}Hsp_identity", "0"))
                       if hsp is not None else 0,
            "score": float(hsp.findtext(f"{ns}Hsp_bit-score", "0"))
                    if hsp is not None else 0,
        })
    return hits


# Example: BLAST a short DNA sequence
rid = submit_blast("ATGCGATCGATCGATCGATCGATCG", program="blastn")
print(f"Submitted BLAST search: {rid}")

wait_for_results(rid)
hits = get_results(rid)
for h in hits[:5]:
    print(f"{h['accession']}: {h['description'][:60]}...")
    print(f"  E-value: {h['evalue']:.2e} | Identity: {h['identity']}")

Rate Limits

  • Max 1 request per 10 seconds for search submission
  • Max concurrent searches: varies by load
  • NCBI requests a contact email in User-Agent header

References

What ships with it

Read from the repository

Just SKILL.md. No reference files, no scripts.

Keep looking

Skills are one crate of 326,144. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.