agentsclimarketplace
Sign in

Crispr offtarget predictor

Skill BioTender-max/awesome-bio-agent-skills/skills/openclaw/crispr-offtarget-predictor

A curated collection of AI agent skills for biomedical research, covering genomics, proteomics, single-cell analysis, clinical AI, and protein design.From the repository description

Install
npx -y skills add BioTender-max/awesome-bio-agent-skills --skill crispr-offtarget-predictor

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

One thing to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.

SKILL.md

1.8 KB, 473 tokens by cl100k_base, as published. Nobody here has run it

<!-- # COPYRIGHT NOTICE # This file is part of the "Universal Biomedical Skills" project. # Copyright (c) 2026 MD BABU MIA, PhD <[email protected]> # All Rights Reserved. # # This code is proprietary and confidential. # Unauthorized copying of this file, via any medium is strictly prohibited. # # Provenance: Authenticated by MD BABU MIA -->

name: 'crispr-offtarget-predictor' description: 'Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.' measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:

  • read_file
  • run_shell_command

CRISPR Off-Target Predictor

This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.

When to Use This Skill

  • Designing new CRISPR experiments.
  • Validating sgRNA specificity before synthesis.
  • Analyzing potential safety risks in gene editing protocols.

Core Capabilities

  1. Mismatch Scoring: Calculates mismatch penalties for potential sites.
  2. PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
  3. Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.

Workflow

  1. Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
  2. Analysis: Scans a reference library (mocked for this version) for similar sequences.
  3. Output: List of potential off-targets with locations and risk scores.

Example Usage

User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."

Agent Action:

python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

What ships with it: 1 file

3.2 KB alongside SKILL.md, 1 of them executable

Keep looking

Skills are one crate of 325,949. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.