Crispr guide design
Skill BioTender-max/awesome-bio-agent-skills/skills/openclaw/crispr-guide-design
A curated collection of AI agent skills for biomedical research, covering genomics, proteomics, single-cell analysis, clinical AI, and protein design.From the repository description
npx -y skills add BioTender-max/awesome-bio-agent-skills --skill crispr-guide-designAssembled from the repository path, not quoted from the project. Check it against their README if it does not work.
One thing to look at
- no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.
SKILL.md
2.5 KB, 661 tokens by cl100k_base, as published. Nobody here has run it
name: crispr-guide-design description: Guide foundry keywords:
- CRISPR
- sgRNA
- Doench
- off-target
- oligos measurable_outcome: Return the requested number of guides (default ≥4) with efficiency + specificity scores, coordinates, and cloning oligos within 10 minutes per gene. license: MIT metadata: author: CRISPR-GPT Team version: "1.0.0" compatibility:
- system: Python 3.10+ allowed-tools:
- run_shell_command
- read_file
CRISPR Design Agent
Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.
When to Use
- Designing CRISPR knockout/knock-in experiments that need validated guides.
- Locating all PAM-compatible target sites in a gene or locus.
- Filtering guides by efficiency/off-target metrics before cloning.
Core Capabilities
- Target discovery: Scan sequences for PAM motifs (e.g., NGG).
- Efficiency scoring: Evaluate GC content, homopolymers, Doench/DeepCRISPR/CFD scores.
- Filtering & ranking: Remove risky guides (SNP overlap, off-target hits) and output the best candidates.
Workflow
- Resolve gene symbol + organism to canonical transcript coordinates and target region.
- Enumerate PAM-compatible sites; extract spacers for the chosen Cas variant.
- Score guides (efficiency + specificity) and compute GC metrics.
- Run off-target search (≤3 mismatches) to flag problematic loci.
- Filter/rank guides, generate cloning oligos/primers, and emit JSON/CSV outputs with coordinates.
Example Usage
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
--sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
--output guides.json
Guardrails
- Always state genome build and Cas variant assumptions.
- Avoid guides overlapping common SNPs when
avoid_variantsis true. - Flag high off-target density near coding regions for manual review.
References
- See
README.mdandprompt.mdfor detailed schema plus supporting literature.
What ships with it: 4 files
11.2 KB alongside SKILL.md, 1 of them executable
- crispr_designer.pyruns3.6 KB
- prompt.md2.8 KB
- README.md2.7 KB
- TUTORIAL_CRISPR_DESIGN.md2.0 KB