agentsclimarketplace

Primer validation

Skill BioTender-max/awesome-bio-agent-skills/skills/bioskills/primer-validation

A curated collection of AI agent skills for biomedical research, covering genomics, proteomics, single-cell analysis, clinical AI, and protein design.

Install
npx -y skills add BioTender-max/awesome-bio-agent-skills --skill primer-validation

Assembled from the repository path, not quoted from the project. Check it against their README if it does not work.

One thing to look at

  • no licenseNo license file was found in the repository. Code published without one is not open source by default, so using it at work is a question for whoever answers licensing questions where you are.

What its author says it does

Copied from the file, not written here

Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.

SKILL.md

10.4 KB, as published. Nobody here has run it

Version Compatibility

Reference examples tested with: pandas 2.2+, primer3-py 2.0+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Primer Validation

Check primers for secondary structures, dimers, and other issues using primer3-py.

"Validate a primer pair" → Check for hairpins, self-dimers, heterodimers, and 3' stability using thermodynamic calculations.

  • Python: primer3.calc_hairpin(), primer3.calc_homodimer(), primer3.calc_heterodimer() (primer3-py)

Required Imports

import primer3

Check Hairpin Formation

primer = 'ATGCGATCGATCGATCGATC'

hairpin = primer3.calc_hairpin(primer)
print(f'Hairpin Tm: {hairpin.tm:.1f}C')
print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol')
print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol')
print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K')

# Hairpin is problematic if Tm > annealing temp - 10
annealing_temp = 60.0
if hairpin.tm > annealing_temp - 10:
    print(f'WARNING: Hairpin Tm too high for annealing at {annealing_temp}C')

Check Self-Dimer (Homodimer)

primer = 'ATGCGATCGATCGATCGATC'

homodimer = primer3.calc_homodimer(primer)
print(f'Homodimer Tm: {homodimer.tm:.1f}C')
print(f'Homodimer dG: {homodimer.dg:.1f} cal/mol')

# Self-dimer is problematic if Tm is close to annealing temp
if homodimer.tm > 40:
    print('WARNING: Significant self-dimer potential')

Check Primer-Primer Dimer (Heterodimer)

forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'

heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'Heterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')

if heterodimer.tm > 40:
    print('WARNING: Significant primer dimer potential between forward and reverse')

Complete Primer Validation

def validate_primer(primer_seq, name='Primer', annealing_temp=60.0):
    '''Comprehensive primer validation'''
    print(f'\n=== Validating {name}: {primer_seq} ===')

    # Basic properties
    tm = primer3.calc_tm(primer_seq)
    gc = (primer_seq.count('G') + primer_seq.count('C')) / len(primer_seq) * 100
    print(f'Length: {len(primer_seq)}bp')
    print(f'Tm: {tm:.1f}C')
    print(f'GC: {gc:.1f}%')

    # Hairpin
    hairpin = primer3.calc_hairpin(primer_seq)
    print(f'Hairpin Tm: {hairpin.tm:.1f}C, dG: {hairpin.dg:.1f}')
    if hairpin.tm > annealing_temp - 10:
        print('  WARNING: Hairpin may interfere with annealing')

    # Homodimer
    homodimer = primer3.calc_homodimer(primer_seq)
    print(f'Homodimer Tm: {homodimer.tm:.1f}C, dG: {homodimer.dg:.1f}')
    if homodimer.tm > 40:
        print('  WARNING: Self-dimer potential')

    # 3' end stability (last 5 bases)
    end_3 = primer_seq[-5:]
    end_gc = (end_3.count('G') + end_3.count('C'))
    print(f"3' end (last 5bp): {end_3}, {end_gc} G/C bases")
    if end_gc > 3:
        print("  WARNING: 3' end may be too GC-rich")
    if end_gc == 0:
        print("  WARNING: 3' end lacks GC clamp")

    # Poly-X runs
    for base in 'ATGC':
        for run_len in range(5, len(primer_seq)):
            if base * run_len in primer_seq:
                print(f'  WARNING: Contains {base}x{run_len} run')
                break

    return {'tm': tm, 'gc': gc, 'hairpin_tm': hairpin.tm, 'homodimer_tm': homodimer.tm}

validate_primer('ATGCGATCGATCGATCGATC', 'Forward')

Validate Primer Pair

def validate_primer_pair(forward, reverse, annealing_temp=60.0):
    '''Validate a primer pair'''
    print(f'\n=== Primer Pair Validation ===')
    print(f'Forward: {forward}')
    print(f'Reverse: {reverse}')

    # Individual primer checks
    fwd_tm = primer3.calc_tm(forward)
    rev_tm = primer3.calc_tm(reverse)
    print(f'\nTm Forward: {fwd_tm:.1f}C')
    print(f'Tm Reverse: {rev_tm:.1f}C')
    print(f'Tm Difference: {abs(fwd_tm - rev_tm):.1f}C')

    if abs(fwd_tm - rev_tm) > 2:
        print('  WARNING: Tm difference > 2C')

    # Heterodimer check
    heterodimer = primer3.calc_heterodimer(forward, reverse)
    print(f'\nHeterodimer Tm: {heterodimer.tm:.1f}C')
    print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')

    if heterodimer.tm > 40:
        print('  WARNING: Significant primer dimer potential')

    # Check 3' complementarity specifically
    end_heterodimer = primer3.calc_heterodimer(forward[-6:], reverse[-6:])
    print(f"3' end heterodimer Tm: {end_heterodimer.tm:.1f}C")
    if end_heterodimer.tm > 20:
        print("  WARNING: 3' ends may form stable dimer")

    # Individual hairpins and homodimers
    fwd_hairpin = primer3.calc_hairpin(forward)
    rev_hairpin = primer3.calc_hairpin(reverse)
    fwd_homodimer = primer3.calc_homodimer(forward)
    rev_homodimer = primer3.calc_homodimer(reverse)

    print(f'\nForward hairpin Tm: {fwd_hairpin.tm:.1f}C')
    print(f'Reverse hairpin Tm: {rev_hairpin.tm:.1f}C')
    print(f'Forward homodimer Tm: {fwd_homodimer.tm:.1f}C')
    print(f'Reverse homodimer Tm: {rev_homodimer.tm:.1f}C')

    return {
        'fwd_tm': fwd_tm,
        'rev_tm': rev_tm,
        'heterodimer_tm': heterodimer.tm,
        'fwd_hairpin_tm': fwd_hairpin.tm,
        'rev_hairpin_tm': rev_hairpin.tm,
    }

validate_primer_pair('ATGCGATCGATCGATCGATC', 'GCTAGCTAGCTAGCTAGCTA')

Calculate End Stability (Native Function)

# Use native calc_end_stability for 3' end thermodynamics
primer = 'ATGCGATCGATCGATCGATC'

# Calculate stability of last 5 bases (default)
end_stability = primer3.calc_end_stability(primer)
print(f"3' end stability: dG = {end_stability.dg:.1f} cal/mol")

# More negative dG = more stable 3' end = better extension but higher mispriming risk
if end_stability.dg < -9000:
    print('  Note: Very stable 3\' end - good extension but watch for mispriming')

Quick Tm-Only Checks (Lightweight)

# For high-throughput screening, use Tm-only functions (return float, not ThermoResult)
primer = 'ATGCGATCGATCGATCGATC'

# Quick hairpin Tm check
hairpin_tm = primer3.calc_hairpin_tm(primer)
print(f'Hairpin Tm: {hairpin_tm:.1f}C')

# Quick homodimer Tm check
homodimer_tm = primer3.calc_homodimer_tm(primer)
print(f'Homodimer Tm: {homodimer_tm:.1f}C')

# Quick heterodimer Tm check
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer_tm = primer3.calc_heterodimer_tm(forward, reverse)
print(f'Heterodimer Tm: {heterodimer_tm:.1f}C')

Fast Batch Screening with Tm-Only Functions

def quick_screen_primers(primer_list, max_hairpin_tm=45, max_homodimer_tm=45):
    '''Fast screening using Tm-only functions'''
    passed = []
    failed = []
    for seq in primer_list:
        hairpin_tm = primer3.calc_hairpin_tm(seq)
        homodimer_tm = primer3.calc_homodimer_tm(seq)
        if hairpin_tm < max_hairpin_tm and homodimer_tm < max_homodimer_tm:
            passed.append(seq)
        else:
            failed.append((seq, hairpin_tm, homodimer_tm))
    return passed, failed

primers = ['ATGCGATCGATCGATCGATC', 'GCGCGCGCGCGCGCGCGCGC', 'ATATATATATATATATATAT']
passed, failed = quick_screen_primers(primers)
print(f'Passed: {len(passed)}, Failed: {len(failed)}')

Check Specificity (3' End)

def check_3prime_specificity(primer_seq):
    '''Check if 3' end is suitable for specific priming'''
    end_5bp = primer_seq[-5:]
    end_3bp = primer_seq[-3:]

    # Count G/C in last 5 bases
    gc_5 = end_5bp.count('G') + end_5bp.count('C')

    # Check last base
    last_base = primer_seq[-1]

    print(f"3' sequence: ...{end_5bp}")
    print(f"G/C in last 5bp: {gc_5}")
    print(f"Last base: {last_base}")

    # Ideal: 1-2 G/C in last 5, ending in G or C
    if gc_5 == 0:
        print('  Consider: No GC clamp at 3\' end')
    elif gc_5 > 3:
        print('  Consider: 3\' end may be too stable (mispriming risk)')

    if last_base in 'AT':
        print('  Consider: Ending in A/T may reduce specificity')

    return {'gc_5': gc_5, 'last_base': last_base}

check_3prime_specificity('ATGCGATCGATCGATCGATC')

Batch Validation

import pandas as pd

def batch_validate_primers(primers):
    '''Validate multiple primers'''
    results = []
    for name, seq in primers.items():
        tm = primer3.calc_tm(seq)
        gc = (seq.count('G') + seq.count('C')) / len(seq) * 100
        hairpin = primer3.calc_hairpin(seq)
        homodimer = primer3.calc_homodimer(seq)

        results.append({
            'name': name,
            'sequence': seq,
            'length': len(seq),
            'tm': round(tm, 1),
            'gc_pct': round(gc, 1),
            'hairpin_tm': round(hairpin.tm, 1),
            'homodimer_tm': round(homodimer.tm, 1),
        })

    return pd.DataFrame(results)

primers = {
    'GAPDH_F': 'GTCTCCTCTGACTTCAACAGCG',
    'GAPDH_R': 'ACCACCCTGTTGCTGTAGCCAA',
    'ACTB_F': 'CATGTACGTTGCTATCCAGGC',
    'ACTB_R': 'CTCCTTAATGTCACGCACGAT',
}

df = batch_validate_primers(primers)
print(df.to_string(index=False))

Thermodynamic Parameters Under Different Conditions

primer = 'ATGCGATCGATCGATCGATC'

# Standard conditions
tm_standard = primer3.calc_tm(primer)
hairpin_standard = primer3.calc_hairpin(primer)

# Custom salt conditions
tm_custom = primer3.calc_tm(primer, mv_conc=100.0, dv_conc=2.0, dntp_conc=0.4, dna_conc=200.0)
hairpin_custom = primer3.calc_hairpin(primer, mv_conc=100.0, dv_conc=2.0)

print(f'Standard conditions: Tm={tm_standard:.1f}C, Hairpin Tm={hairpin_standard.tm:.1f}C')
print(f'Custom conditions:   Tm={tm_custom:.1f}C, Hairpin Tm={hairpin_custom.tm:.1f}C')

Validation Thresholds

PropertyAcceptableOptimal
Length18-30 bp20-25 bp
Tm55-65C58-62C
GC%35-65%45-55%
Hairpin Tm<45C<35C
Homodimer Tm<45C<35C
Heterodimer Tm<45C<35C
3' GC (last 5bp)1-32

Related Skills

  • primer-basics - Design new primers with primer3
  • qpcr-primers - Design and validate qPCR assays
  • database-access/local-blast - BLAST primers against genome for specificity

Keep looking

Skills are one crate of 328,083. Ordering is by how many stacks a row turns up in, so the top of any crate is what has actually been picked rather than what has the most stars.